Category Archives: Uncategorized

To introduce the FLP recombinase gene under the control of an ind

To introduce the FLP recombinase gene under the control of an inducible promoter into pKFRT, inverse-PCR was performed using the primers FRT-rightR/Inv-pUC118F. A cassette containing tetR, the Ptet promoter, and flp recombinase was amplified by PCR from pFT-A [34] using … Continue reading

Posted in Uncategorized | Leave a comment

Mol Cell Biol 2008,28(17):5369–5380 PubMedCrossRef 16 Selaru FM,

Mol Cell Biol 2008,28(17):5369–5380.PubMedCrossRef 16. Selaru FM, Olaru AV, Kan T, David S, Cheng Y, Mori Y, Yang J, Paun B, Jin Z, Agarwal R, Hamilton JP, Abraham J, Georgiades C, Alvarez H, Vivekanandan P, Yu W, Maitra A, Torbenson … Continue reading

Posted in Uncategorized | Leave a comment

Acknowledgements A sincere thanks is given to Dr Roger Harris, U

Acknowledgements A sincere thanks is given to Dr. Roger Harris, University of Chichester, Chichester, UK, for his time and input he contributed to reviewing this manuscript. The authors would also like to thank FSI Nutrition, 2132 South 156th Circle, Omaha, … Continue reading

Posted in Uncategorized | Leave a comment


C McKay2, R Navarro-González3 1Instituto de

Cruz-Kuri1, C. McKay2, R. Navarro-González3 1Instituto de Ciencias Básicas. University of Veracruz. MEXICO; 2Ames Research Center. NASA. USA; 3Instituto de Ciencias Nucleares. UNAM. MEXICO We are interested in treelines because of Mars and the possibility that in the future it … Continue reading

Posted in Uncategorized | Leave a comment

Primers for probes amplifying hrtB and hssR: hrtB-1F:(5′CACTCAATA

Primers for probes amplifying hrtB and hssR: hrtB-1F:(5′CACTCAATAAATGTCTTGTC3′), hrtB-2R: (5′AAGGTAATTCATCAAGAACC3′), hssR-1F: (5′AATGTCTTGTTGTCGATGAC3′), hssR-2R:(5′ TTATAGCCTTGTCCTCTTAC3′). All steps were repeated in two independent experiments giving similar results. Quantitative RT-PCR: RNA was treated with DNase and RevertAid™ H Minus first strand cDNA synthesis … Continue reading

Posted in Uncategorized | Leave a comment

Both mutants have stable mutations in target genes and will be re

Both mutants have stable mutations in target genes and will be referred to as 13124R and NCTRR in this study. Both mutants had a mutation in gyrA (G81C, D87Y), 13124R had mutation in gyrB (A431S) and parC (S89I), and NCTRR … Continue reading

Posted in Uncategorized | Leave a comment

Jeor equation [23] x an activity factor of 1 2 In an effort to d

Jeor equation [23] x an activity factor of 1.2. In an effort to decrease variability, the 500 kcal deficit was prescribed consistently to every subject based on estimated energy expenditures from the Mifflin-St. Jeor equation, as opposed to targeting the 500 kcal … Continue reading

Posted in Uncategorized | Leave a comment

J Mol Biol 2005,348(4):817–830 PubMedCrossRef 29 Brown NF, Valla

J Mol Biol 2005,348(4):817–830.PubMedCrossRef 29. Brown NF, Vallance BA, Coombes BK, Valdez Y, Coburn BA, Finlay BB: Salmonella pathogenicity island 2 is expressed prior to penetrating the intestine. PLoS pathogens 2005,1(3):e32.PubMedCrossRef 30. Coombes BK, Wickham ME, Lowden MJ, Brown NF, … Continue reading

Posted in Uncategorized | Leave a comment

Nanoscale Res Lett 2013, 8:87 CrossRef

Nanoscale Res Lett 2013, 8:87.CrossRef this website 3. Jo K, Chen YL, De Pablo JJ, Schwartz DC: Elongation and migration of single DNA molecules in microchannels using oscillatory shear flows. Lab Chip 2009, 9:2348–2355.CrossRef 4. Gulati S, Liepmann D, Muller … Continue reading

Posted in Uncategorized | Leave a comment

This treatment was continued for total 3 times and the rats were

This treatment was continued for total 3 times and the rats were sacrificed at day 30 after the last DAPM injection (Figure 2A). The livers were harvested and utilized for DPPIV histochemistry. Additional two groups of normal rats ware given … Continue reading

Posted in Uncategorized | Leave a comment