Primers for probes amplifying hrtB and hssR: hrtB-1F:(5′CACTCAATAAATGTCTTGTC3′), hrtB-2R: (5′AAGGTAATTCATCAAGAACC3′), hssR-1F: (5′AATGTCTTGTTGTCGATGAC3′), hssR-2R:(5′ TTATAGCCTTGTCCTCTTAC3′). All steps were repeated in two independent experiments giving similar results. Quantitative RT-PCR: RNA was treated with DNase and RevertAid™ H Minus first strand cDNA synthesis Kit (Fermentas). The Mx30000P® and Maxima® SYBR Green/ROX qPCR Master Mix (Fermentas) was used essentially as described by the manufacturer. The Real-Time reaction was run under the following conditions: Segment 1: Initial denaturation
95C 10 minutes, Segment 2: 95°C 30 s, 55°C 1 min, 72°C 30 s, for 40 cycles, Segment 3: 95°C 1 min, ramp down to 50°C and ramp up from 50°C
to 95°C. Primers amplifying hrtB (Per1-F Decitabine order + Per2-R), hssR (RR1-F+ RRS-R) and ileS (ileS-Forward BVD-523 manufacturer + ileS-Reverse) which was used for normalisation: Per1-F:(5′TGAGGCACCTAAAATCGCTAC3′), Per2-R:(5′GGGAGAATATTTCGTTATTTGAACAC3′), RR1-F:(5′ACATTGATGCATACACACAACC3′), RR2-R:(5′GTCAACTGTTCGCTCATCTCC3′), ileS-Forward:(5′TTTAGGTGTTCGTGGTGA3′), ileS-Reverse:(5′CTTTATCTGCCATTTCTCC3′). All steps were repeated in three independent experiments giving similar results. Statistical analysis on QRTPCR results using GraphPad prism5, 1Way Anova with Dunnett’s Multiple comparison test (GraphPad Software, Inc) determined changes in expression comparing time 0 to time 10 minutes or 90 minutes. Stress and antibiotic resistance of S. aureus and L. monocytogenes Cultures of S. aureus and L. monocytogenes were grown exponentially in TSB and BHI, respectively, at 37°C. At an absorbance at 600 nm of 0.2 +/- 0.05 the cultures were diluted 10-1, 10-2, 10-3 and 10-4fold, and 10 μl of each dilution was spotted on TSB or BHI plates. The plates were incubated at the indicated temperatures. In addition plates containing 4% NaCl were spotted and incubated in a similar way. Antimicrobial susceptibility to ampicillin,
gentamicin, sulfa/trimethoprim, rifampicin, tetracycline, amoxy/clavulan, Exoribonuclease cephalotin, clindamycin, enrofloxacin, fusidic acid and oxacillin was performed with a commercially available MIC technique using dehydrated antimicrobials in microtitre wells (Trek Diagnostic Systems Ltd., UK). Acknowledgements We thank Dr. Iñigo Lasa, Universidad Pública de Navarra, Spain, for providing the S. aureus 15981 and 15981 ΔTCS15 and we thank Birgitte Kallipolitis, University of Southern Denmark, for providing L. monocytogenes RR23. LET was funded by a grant from the Danish Technical Research Council, CTG was funded by a PhD-grant from the Technical University of Denmark and SGT was funded by a PhD-grant from The Lundbeck Foundation and University of Copenhagen. References 1. Bax R, Mullan N, Verhoef J: The millennium bug – the need for and development of new antibacterials. Int J antimicrob Agents 2000, 16:51–59.