Monthly Archives: April 2019

All data were expressed in mean ± SD. The data presented in some figures are from a representative experiment, which was qualitatively similar in the replicate experiments. Statistical significance was determined with Student’s t test (two-tailed) comparison between two groups of data … Continue reading →

Up to now, a family of hierarchical α-Fe2O3 architectures (microring [7], melon-like [25], columnar Venetoclax mouse [29], and nanotube [30] arrays; nanoplatelets [31]; peanut- [32], cantaloupe- [33], or urchin-like [34] nanoarchitectures, etc.) have been available. Most recently, novel hollow architectures … Continue reading →

To introduce the FLP recombinase gene under the control of an inducible promoter into pKFRT, inverse-PCR was performed using the primers FRT-rightR/Inv-pUC118F. A cassette containing tetR, the Ptet promoter, and flp recombinase was amplified by PCR from pFT-A [34] using … Continue reading →

Mol Cell Biol 2008,28(17):5369–5380.PubMedCrossRef 16. Selaru FM, Olaru AV, Kan T, David S, Cheng Y, Mori Y, Yang J, Paun B, Jin Z, Agarwal R, Hamilton JP, Abraham J, Georgiades C, Alvarez H, Vivekanandan P, Yu W, Maitra A, Torbenson … Continue reading →

Acknowledgements A sincere thanks is given to Dr. Roger Harris, University of Chichester, Chichester, UK, for his time and input he contributed to reviewing this manuscript. The authors would also like to thank FSI Nutrition, 2132 South 156th Circle, Omaha, … Continue reading →

Cruz-Kuri1, C. McKay2, R. Navarro-González3 1Instituto de Ciencias Básicas. University of Veracruz. MEXICO; 2Ames Research Center. NASA. USA; 3Instituto de Ciencias Nucleares. UNAM. MEXICO We are interested in treelines because of Mars and the possibility that in the future it … Continue reading →

Primers for probes amplifying hrtB and hssR: hrtB-1F:(5′CACTCAATAAATGTCTTGTC3′), hrtB-2R: (5′AAGGTAATTCATCAAGAACC3′), hssR-1F: (5′AATGTCTTGTTGTCGATGAC3′), hssR-2R:(5′ TTATAGCCTTGTCCTCTTAC3′). All steps were repeated in two independent experiments giving similar results. Quantitative RT-PCR: RNA was treated with DNase and RevertAid™ H Minus first strand cDNA synthesis … Continue reading →

Both mutants have stable mutations in target genes and will be referred to as 13124R and NCTRR in this study. Both mutants had a mutation in gyrA (G81C, D87Y), 13124R had mutation in gyrB (A431S) and parC (S89I), and NCTRR … Continue reading →

Jeor equation [23] x an activity factor of 1.2. In an effort to decrease variability, the 500 kcal deficit was prescribed consistently to every subject based on estimated energy expenditures from the Mifflin-St. Jeor equation, as opposed to targeting the 500 kcal … Continue reading →

J Mol Biol 2005,348(4):817–830.PubMedCrossRef 29. Brown NF, Vallance BA, Coombes BK, Valdez Y, Coburn BA, Finlay BB: Salmonella pathogenicity island 2 is expressed prior to penetrating the intestine. PLoS pathogens 2005,1(3):e32.PubMedCrossRef 30. Coombes BK, Wickham ME, Lowden MJ, Brown NF, … Continue reading →