Endoplasmic reticulum stress related factor IRE1α regulates TXNIP/NLRP3-mediated pyroptosis in diabetic nephropathy
Ruiqiong Ke, Yan Wang, Shihua Hong, Lixia Xiao
PII: S0014-4827(20)30542-5
DOI: https://doi.org/10.1016/j.yexcr.2020.112293 Reference: YEXCR 112293
To appear in: Experimental Cell Research
Received Date: 26 May 2020
Revised Date: 14 September 2020
Accepted Date: 15 September 2020
Please cite this article as: R. Ke, Y. Wang, S. Hong, L. Xiao, Endoplasmic reticulum stress related factor IRE1α regulates TXNIP/NLRP3-mediated pyroptosis in diabetic nephropathy, Experimental Cell Research (2020), doi: https://doi.org/10.1016/j.yexcr.2020.112293.
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2020 Published by Elsevier Inc.
Author contributions
RQK is the guarantor of integrity of the entire study; RQK contributed to the study concepts, study design, and definition of intellectual content, YW contributed to the manuscript preparation and SHH contributed to the manuscript editing and review; RQK contributed to the clinical studies; YW and SHH contributed to the experimental studies and data acquisition; LXX contributed to the data analysis and statistical analysis. All authors read and approved the final manuscript.
Endoplasmic reticulum stress related factor IRE1α regulates TXNIP/NLRP3-mediated pyroptosis in diabetic nephropathy
Running title: IRE1α/TXNIP/NLRP3 in pyroptosis in DN
Ruiqiong Ke, Yan Wang, Shihua Hong, Lixia Xiao*
Department of Endocrinology, The First Affiliated Hospital of Gannan Medical College, No. 128, Jinling Road, Ganzhou 341000, Jiangxi Province, China.
*Corresponding Author: Lixia Xiao, The First Affiliated Hospital of Gannan Medical College, No. 128, Jinling Road, Ganzhou 341000, Jiangxi Province, China.
E-mail: [email protected] Tel: +86-0797-8689228
Abstract
The nod-like receptor protein-3 (NLRP3)-mediated pyroptosis is involved in kidney diseases. Thioredoxin interacting protein (TXNIP) directly interacts with NLRP3. This study aimed to probe the mechanism of TXNIP and NLRP3 pathway in diabetic nephropathy (DN). Marker detection and histological staining indicated that in DN rats, the renal function was destroyed, and the TXNIP/NLRP3 axis was activated to induce inflammatory generation and pyroptosis. The protein levels of TXNIP, NLRP3 inflammatory components and endoplasmic reticulum stress (ERS)-related factors (ATF4, CHOP and IRE1α) were measured. DN rats were injected with LV-TXNIP-shRNA or IRE1α RNase specific inhibitor (STF-083010) to examine ERS- and pyroptosis-related proteins, and renal injury. Silencing TXNIP inhibited the NLRP3 axis and reduced renal damage in DN rats. ERS was activated in DN rats, and miR-200a expression was degraded by IRE1α. miR-200a bound to TXNIP. NRK-52E cells were induced by high glucose (HG) to simulate DN in vitro. The damage and pyroptosis of NRK-52E cells were analyzed. After inhibiting IRE1α, miR-200a expression increased and TXNIP expression decreased. miR-200a inhibition in HG-induced NRK-52E cells partially reversed the reduced pyroptosis by STF-083010. Overall, IRE1α upregulates miR-200a degradation in DN rats, and stimulates the TXINP/NLRP3 pathway-mediated pyroptosis and renal damage.
Key words: Diabetic nephropathy; Pyroptosis; Endoplasmic reticulum stress; TXINP; NLRP3; microRNA-200a; IRE1α
⦁ Introduction
Diabetic nephropathy (DN) is a leading complication of diabetes, which often develops into end-stage renal disease [1]. DN is characterized with thickening of the glomerular basement membranes, glomerular capillary damage, inflammation and oxidative stress, expansion of mesangium, and appearance of urinary microalbumin (mALB) [2]. Growing evidence demonstrates that activated inflammation is a leading contributor to the pathogenesis of DN [3]. Stimulation of the endoplasmic reticulum (ER) initiates unfolded protein response (UPR), and eventually leads to the activation of ER stress (ERS) [4], which participates in pathophysiological developments of diabetes and related chronic complications [5]. ERS contributes to DN progression and promotes end-stage renal failure in diabetic patients [6]. Although several studies have evaluated the potential causes of DN, its unique pathophysiology has not been fully identified [7]. Interestingly, streptozotocin (STZ)-induced DN can be relieved by regulating ERS-mediated inflammation [8]. Therefore, we are inspired to figure out novel treatment for DN patients from the perspective of ERS-mediated inflammation.
Pyroptosis is a type of inflammatory programmed cell death induced by inflammatory caspase-1 and pro‑inflammatory mediators and exhibits morphological characteristics that are common to apoptosis and necrosis [9-11]. Pyroptosis is characterized by activation of nod-like receptor protein-3 (NLRP3) inflammasome and caspase, swelling and rupture of cells, and the release of interleukin (IL)-1β and IL-18 [12, 13]. The participation of pyroptosis in cancers, cardiovascular diseases and microbial infection-related diseases is a relative hot spot in recent years [13-15]. However, the regulatory mechanism of pyroptosis in DN is less studied. Pyroptosis is closely related to the activation of NLRP3 inflammasome, which is linked to hyperlipidemia, diabetes and hypertension [14]. Small molecule inhibitors targeting
NLRP3 inflammatory bodies are potential options for DN treatment [16]. Importantly, suppression of NLRP3 inflammasome pathway via downregulating of thioredoxin-interacting protein (TXNIP) in hippocampus alleviates memory and cognitive dysfunction in diabetic mice through alleviation of ERS [17]. Additionally, TXNIP levels are most abundantly expressed in the glomeruli in human and rat kidneys [18], and a study has demonstrated its upregulation in response to high glucose (HG) in DN rats [19]. Zhou et al. provided evidence of TXNIP as a binding partner to NLRP3, and their association was crucial for downstream inflammasome activation [20]. However, the roles of pyroptosis induced by NLRP3 inflammasome activation and TXNIP in DN rats are unclear. Therefore, the comprehensive in vivo and in vitro experiments were conducted in this study to testify the involvement of NLRP3 inflammasome and TXNIP in pyroptosis -induced renal injury in DN rats, which may offer novel insights for therapeutic interventions for DN patients.
⦁ Materials and methods
⦁ Ethics statement
This study was ratified and supervised by the ethics committee of The First Affiliated Hospital of Gannan Medical College. All experiments and procedures were conducted in accordance with the laboratory animal care and use guidelines of National Institutes of Health, making every effort to reduce the pain of animals and the number of animals used.
⦁ Animal treatment and grouping
Specific pathogen-free male Sprague Dawley rats (180-200 g) were purchased from Shanghai Sixth People’s Hospital (SYXK (Shanghai) 2016-0020). During the whole experiment, the rats were raised in the standard laboratory conditions at 25 ±
2‑, with 12 hours light/dark cycle and free access to water and food. The rats were euthanized by intraperitoneal injection of sodium pentobarbital (800 mg/kg).
According to the DN modeling method introduced in literatures [21, 22], the rats were randomly assigned into control group (n = 6) and DN group (n = 30). The control rats received standard diet, and the diabetic rats received high-fat feeding for 4 weeks. Then the rats in the DN group were injected with STZ (35 mg/kg, 0.1 mM sodium citrate solution, pH = 4.4), the control rats were fed with the same amount of sodium citrate solution intraperitoneally for 4 weeks. The blood was taken from tail vein at 72 hours after injection to detect the blood glucose content of rats through a blood glucose meter (06662602B; Johnson & Johnson, New Brunswick, NJ, USA). The blood glucose content more than 16.7 mM [23] indicated the model was successfully established.
Afterwards, 24 diabetic rats were randomly assigned into 4 groups (n = 6 in each group). According to the reference [24], 1 × 108 TU of lentivirus-TXNIP-small hairpin RNA shRNA (LV-TXNIP-shRNA) or its corresponding negative control (LV-NC) were injected into the carotid artery 72 hours after STZ injection, or Vehicle (2% dimethyl sulphoxide (DMSO) + 40% PEG300 + 5% Tween 80 + ddH2O) or 30 mg/kg STF-083010 (RNase specific inhibitors of inositol-requiring enzyme 1α (IRE1α); Selleck, Houston, TX, USA) was injected intraperitoneally 72 hours before sampling. The rats were correspondingly allocated into DN + LV-NC, DN + LV-TXNIP-shRNA, DN + Vehicle and DN + STF-083010 groups. The LV-TXNIP-shRNA vector and its LV-NC were constructed and synthesized by Shanghai GenePharma Co, Ltd, Shanghai, China (Shanghai, China).
⦁ Detection of renal function indices
After fasting for 12 hours, the rats were anesthetized with 60 mg/kg pentobarbital sodium, and the blood was obtained from the tail vein, and the supernatant was centrifuged at 3000 rpm for 15 minutes after standing for 30 minutes. The contents of blood urea nitrogen (BUN) and serum creatinine (Scr) in the sera of the rats were measured according to the operation steps of the BUN kit (C013-2-1; Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China) and Scr kit (C011-1-1, Nanjing Jiancheng).
The rats were placed in the metabolic cages at 2 rats/cage with free feed and drinking water. The sterile centrifuge tubes were placed in the urine collection place, and 24 hours later, the urine was taken out and the volume was recorded and mixed evenly. Then the concentration of urinary mALB was detected by the kit (E038-1-1; Nanjing Jiancheng).
⦁ Hematoxylin and eosin (HE) staining
One side of the kidney was fixed with 4% paraformaldehyde, dehydrated with regular ethanol, embedded in paraffin, and sectioned at 3 μm. After that, the sections were dewaxed with xylene and dehydrated with ethanol. After dewaxing and dehydration, the sections were subjected to hematoxylin staining, hydrochloric acid ethanol differentiation and eosin staining. Then the sections were dehydrated and cleared in gradient ethanol and xylene, air-dried, and sealed using the neutral gum. Finally, the sections were observed and photographed (40 x) under the optical microscope (Olympus, Tokyo, Japan).
⦁ Sirius red staining
The sections were made according to HE staining, dewaxed and dehydrated, then soaked for 5 minutes in distilled water, and stained for 1 hour with Sirius red staining solution in the dark. Then the sections were washed twice with 0.5% glacial acetic
acid solution to remove the motley. After dehydration, the sections were sealed with neutral gum and observed under the microscope (40 x).
⦁ Periodic acid-schiff (PAS) staining
Paraffin section preparation and treatment before staining were consistent with that in HE staining and Sirius red staining. The treated tissues were treated with 0.5% periodic acid solution for 10 minutes, stained with Sciff’s solution (90‑) for 3-10 minutes after washing, and then taken out when stained in red. After that, sections were washed with tap water for 7-10 minutes, stained with hematoxylin for 1 minute, then dehydrated, cleared and sealed, and observed under the microscope. The pathological changes of kidney such as glomerulus and mesangial matrix were observed in 5 random visual fields from each section, and the degree of glomerulosclerosis in each section was scored 0-5 points. The scoring criteria were: 0 score for normal; 1 score for mild glomerular injury, mesangial cell proliferation, mesangial matrix or hyaline degeneration area/glomerular area < 10%; 2 scores for mesangial matrix or hyaline degeneration area/glomerular area within 10%-20%; 3 scores for mesangial matrix or hyaline degeneration area/glomerular area within 20%-30%; 4 scores for mesangial matrix or hyaline degeneration area/glomerular area within 30%-40%; 5 scores for mesangial matrix or hyaline degeneration area/glomerular area > 40%. The glomerular sclerosis index (GSI) was obtained by statistical analysis of the scores.
⦁ Immunohistochemistry
According to the instructions provided by Boster Biological Technology Co., Ltd (Wuhan, Hubei, China), we carried out immunohistochemistry experiments on renal paraffined sections. In short, paraffined sections were dewaxed and dehydrated in a standardized way, and then endogenous enzymes were inactivated with 3% H2O2.
Sodium citrate antigen repair solution was used for antigen thermal repair. The sections were sealed with 5% bovine serum albumin sealing solution and then incubated with primary antibodies [fibronectin (FN) (1/200, ab2413), NLRP3 (1/200, ab214185), IL-1β (1/200, ab9722) and IL-18 (1/2000, ab223293)] at 4‑ overnight. Thereafter, the sections were cultured with the secondary antibody goat anti-rabbit immunoglobulin G (IgG) H&L labeled by horseradish peroxidase (HRP) (1/2000, ab205718) at 37‑ for 20 minutes, then incubated with streptavidin-biotin complex at 37‑ for 20 minutes, and visualized with 2,4-diaminobutyric acid.
⦁ TUNEL assay
According to the description of literature [25, 26], the rate of positive cells in renal tissue was detected by TUNEL staining to reflect the pyroptosis.
⦁ Culture and treatment of renal tubular epithelial cells
Rat proximal renal tubular epithelial cells (NRK-52E) obtained from Shanghai Institute of cell biochemistry, Chinese Academy of Sciences (Shanghai, China) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (containing 5 mM sugar; Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (Invitrogen) at 37‑ with 5% CO2. The HG medium was used to simulate the model of diabetes in vitro. The control (normal glucose, NG) group was the serum-free medium of normal glucose DMEM with 5 mM sugar, and the HG group was the serum-free medium of HG-DMEM with 30 mM sugar. The culture time was 0, 12, 24, 36 and 48 hours respectively.
After HG induction for 48 hours, the NRK-52E cells were treated with 50 μm STF-083010 alone or in combination with miR-200a inhibitor and its NC according to the instructions of Lipofectamine 2000 (Invitrogen) for 48 hours; or the HG-induced
NRK-52E cells were transfected with serum-free LV-TXNIP-shRNA (multiplicity of infection = 10) or LV-NC for 48 hours.
⦁ 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay
NRK-52E cells at 1 × 105 cells/ mL were seeded into 96-well microplates, and 200 μL MTT solution (0.5 mg/mL) was added to NRK-52E cells after the above experimental treatment to detect the cell viability. Then 150 μL DMSO was added into each well to dissolve the crystal at room temperature for 15 minutes, and absorbance at 490 nm was detected after different treatment.
⦁ Enzyme-linked immunosorbent assay (ELISA)
Renal tissue or NRK-52E cells were homogenized to extract supernatant. The expressions of kidney injury molecule-1 (KIM-1), IL–1β and IL-18 in kidney tissue or NRK-52E cells were detected according to KIM-1 (MBS564137, MyBioSource, USA), IL-1β (H002) and IL-18 (H015) kits respectively (Nanjing Jiancheng).
⦁ Quantitative real-time polymerase chain reaction (qRT-PCR)
According to the method of a TRIzol kit (Invitrogen), the total RNA of rat kidney tissue and NRK-52E cells was extracted, and the concentration of total RNA was determined by micro spectrophotometer (ALLSHENG Instrument Co., Ltd., Hangzhou, China). After that, the PrimeScript RT kit (Takara Bio Inc., Kyoto, Japan) was used to reverse transcribe the total RNA into cDNA according to the instructions, and then SYBR Premix Ex Taq II (Takara) was used for real-time fluorescent quantitative PCR experiment. PCR primers (Table 1) were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 was used as the internal
reference. Each sample was set with 3 complex wells to obtain the average value. The gene expression was calculated using the 2-∆∆t method.
⦁ Western blot analysis
The kidney tissue on the other side of the rat or NRK-52E cells were collected, and the protein lysate (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) was prepared according to the ratio of radio-immunoprecipitation assay buffer: phenylmethylsulfonyl fluoride = 100:1. The samples were ground using an automatic grinder (JXFSTPRP-24; Shanghai Jingxin Industrial Development Co., Ltd., Shanghai, China) for 2 minutes, and were fully lysed on ice for 10 minutes centrifuged at 4‑ 12000 rpm for 30 minutes. Then the concentration of the collected protein samples was detected by bicinchoninic acid protein detection kit (Nanjing Jiancheng), and the concentration was unified. The protein samples were separated using sodium dodecyl sulphate-polyacrylamide gel electrophoresis, and transferred into polyvinylidene fluoride (PVDF) membranes. Then, the PVDF membranes were washed 3 times in tris-buffered saline-tween (TBST) buffer, and blocked with milk blocking liquid for 1 hour. After that, the membranes were immersed overnight in primary antibody solutions and for 1 hour in secondary goat anti-rabbit IgG H&L (HRP) (1/2000, ab205718) antibody. The membranes were developed and the protein bands were analyzed using Image-Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD, USA). The primary antibodies were activating transcription factor 4 (ATF4, 1/1000, ab23760), CHOP (1/1000, 2895, Cell Signaling), TXNIP (1/1000, ab188865),
NLRP3 (1/1000, ab214185), apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC, 1/1000, ab175449), cleaved caspase-1 (1/1000, ab238972), GSDMD-N (1:1000, 93709, cell signaling), spliced X-box binding protein 1 (XBP-1) (XBP-1s, 1/1000, 40435, Cell Signaling), IRE1α (phospho S724) antibody
(1/1000, ab48187), IRE1α antibody (1/1000, ab37073) and β-actin (1/5000, ab179467).
⦁ Electrophoretic analysis of XBP-1s
XBP-1 mRNA was semi-quantitatively reacted in rat kidney and NRK-52E cells. The total RNA was reverse transcribed and XBP-1 fragments were amplified: forward 5’-TTACGAGAGAAAACTCATGGGC-3’ and reverse
5’-GGGTCCAACTTGTCCAGAATGC. According to the literature [27, 28], PstI restriction endonuclease was used to react with PCR products, and GAPDH (forward 5’- CCCCAATGTATCCGTTGTGGA-3’ and reverse
5’-GCCTGCTTCACCACCTTCT was used as the control. The UVP image analysis system (Gel-Pro Analyzer Version 3) was used to analyze the band density and the semi-quantitative test of XBP-1s/unspliced XBP1 (XBP-1u) to calculate the relative activity of XBP-1s.
⦁ Co-immunocoprecipitation assay
Pierce ™ Co-immunoprecision kit (26149, Thermo Scientific) was used to detect the interaction between TXNIP and NLRP3 in NRK-52E cells, and the operation was carried out in strict accordance with the manufacturer’s instructions [29,30]. The protein extract was precipitated with anti-NLRP3 (1:30; ab263899) or IgG (1:100; ab172730). The precipitated protein was evaluated by anti-TXNIP and Western blot analysis. IgG was used as the negative control.
⦁ Dual luciferase reporter gene assay
The binding site of TXNIP and miR-200a was predicted by bioinformatics website Starbase [31], and the binding site sequence or their mutants were amplified and inserted into pmiR-GLO luciferase vector (Promega, Madison, WI, USA) to construct the wild type (WT) or mutant (MUT) of TXNIP. Subsequently, HEK293T
cells (Shanghai Institute of cell biochemistry, Chinese Academy of Sciences) were cotransfected with miR-200a mimic or its mimic NC for 48 hours, and dual luciferase® reporter assay system (E1910, Promega) was used to detect the luciferase activity before and after the transfection. Firefly luciferase and Renilla luciferase activities were detected according to the steps in the instructions. The relative luciferase activity was the activity of firefly luciferase/Renilla luciferase. The experiment was repeated 3 times.
⦁ Statistical analysis
SPSS 21.0 statistical software (IBM Corp. Armonk, NY, USA) was used to process the data. All the data were inspected with normality distribution by the Kolmogorov-Smirnov test, and presented as mean ± standard deviation. The comparisons between two groups were done by the independent-sample t test and the comparisons among multiple groups were conducted by the one-way or two-way analysis of variance (ANOVA). Graphpad Prism 8.0 (GraphPad Software, San Diego, CA, USA) was utilized for mapping. A probability value of P < 0.05 indicated the difference was statistically significant.
⦁ Results
⦁ Identification of the DN rat model
After intraperitoneal injection of STZ to construct the DN model in rats, the fasting blood glucose of rats in each group was detected. The blood glucose content in the sera of DN rats was markedly elevated compared with that of control rats, indicating that the glucose metabolism of DN rats was seriously disordered (Supplementary figure A, all p < 0.01). Then we detected the content of BUN, an important index to judge the glomerular filtration function, and found that compared
with the control rats, DN rats showed significantly increased content of BUN in the sera, and the renal filtration function was significantly impaired. At the same time, we detected the content of Scr and mALB in the sera of DN rats, and found that the content of Scr and mALB in the sera of DN rats was significantly increased (Supplementary figure B, all P < 0.01).
The results of HE staining demonstrated that the structure of glomeruli and renal tubules in control rats was complete, the outline of glomeruli was clear, the renal tubules was evenly arranged; but in DN rats, the glomeruli were hyperplasia and hypertrophy, the outline of glomeruli was not clear, the basement membrane of glomeruli was thickened and adhesive, some renal tubules were atrophic and dilated, and there were colloid tubules in the lumen, proliferation of interstitial fibrous tissue and infiltration of inflammatory cells.
The Sirius red staining found that the positive area of Sirius red staining in control rats was lower, that is, the collagen deposition was lighter; while the positive area of Sirius red staining in the glomerulus and renal tubules of DN rats increased significantly, and collagen deposition was obvious. PAS staining evaluated the degree of glomerular sclerosis. Compared with the control rats, the GSI of DN rats was significantly increased. FN is the key component of extracellular matrix. In the case of renal injury, FN of glomerular and tubular basement membrane is significantly increased. Compared with control rats, FN protein level in glomeruli and renal tubules elevated significantly (Supplementary figure C, all p < 0.01). ELISA showed that KIM-1 level in the kidney of DN rats was higher than that in control rats, which further confirmed the successful construction of DN model (Supplement figure D, all p < 0.01).
⦁ DN rats activated pyroptosis in renal cells
To explore the mechanism of DN in rats, we discovered the levels of NLRP3 inflammatory body components (NLRP3, ASC and cleaved caspase-1) were significantly upregulated, and the protein level of TXNIP was increased. TXNIP can regulate pyroptosis by regulating NLRP3 [32, 33]. Therefore, we observed pyroptosis by lentivirus vector-mediated TXNIP silencing (LV-TXNIP-shRNA) in DN rats. Compared with DN rats, the levels of NLRP3, ASC, cleared caspase-1 and GSDMD-N in kidney tissue of DN rats after inhibiting TXNIP expression were significantly reduced (Figure 1A, p < 0.01). Compared with control rats, DN rats showed significantly upregulated expression of IL-1 β and IL-18 in renal tissue, which were reversed by TXNIP inhibition (Figure 1B, all p < 0.01). TUNEL staining showed that the cell death in renal tissue of DN rats was significantly increased, while TXNIP inhibition notably reduced the cell death (Figure 1C, p < 0.01). To sum up, the TXNIP/NLRP3 axis in DN rats is activated, which mediates the release of inflammatory factors, and regulates caspase-1-dependent programmed cell apoptosis, and ultimately induces pyroptosis in DN rats.
⦁ Inhibition of TXNIP reduced renal injury in DN rats
We silenced TXNIP expression in the kidney of DN rats by lentivirus vector and observed the renal injury. The content of BUN, Scr and mALB in sera of DN rats injected with LV-TXNIP-shRNA were significantly reduced (Figure 2A, all p < 0.01). Then we observed the renal pathological changes of DN rats by HE staining, Sirius red staining and PAS staining. LV-TXNIP-shRNA intervention improved the pathological changes of DN rats, such as glomerular hypertrophy, mesangial area widening, mesangial matrix hyperplasia, glomerular basement membrane thickening, renal tubule mild expansion and local inflammatory cell infiltration of renal interstitium, and reduction of collagen deposition. GSI in DN + LV-TXNIP-shRNA
rats was lower than that in DN + LV-NC rats, and FN expression was increased (Figure 2B, p < 0.01). Subsequently, ELISA showed that KIM-1 expression in DN + LV-TXNIP-shRNA rats was significantly downregulated compared with that in DN + LV-NC rats (Figure 2C, p < 0.01).
⦁ Inhibition of IRE1α activity upregulated miR-200a to downregulate TXNIP
In previous studies [30, 34], ERS can regulate pyroptosis by the TXNIP/NLRP3 axis. Therefore, we detected the expression of several ER-related molecules (ATF4, CHOP and IRE1α), and found that the levels of ATF4, CHOP and the phosphorylation of IRE1α were significantly increased in DN rats (Figure 3A, all p < 0.01). IRE1α mediates the degradation of specific miR, including miR-200a related to DN [27, 35, 36]. To verify the relationship between IRE1α and miR-200a, we injected the RNase specific inhibitor STF-083010 of IRE1α into the abdominal cavity of DN rats, and found XBP-1s expression [27] regulated by the RNase activity of IRE1α was significantly downregulated, indicating that the RNase activity of IRE1α was inhibited (Figure 3B/C, p < 0.01). qRT-PCR showed that miR-200a expression was significantly upregulated when the RNase activity of IRE1α was inhibited, indicating that IRE1α mediates the degradation and expression of miR-200a (Figure 3D, p < 0.01). Then we found a specific binding site between miR-200a and TXNIP through bioinformatics prediction and dual-luciferase reporter assay (Figure 3E, all p < 0.01). After inhibition of IRE1α expression, TXNIP levels were evidently downregulated in DN rats (Figure 3F/G, p < 0.01). These results suggested that ERS was activated in DN rats, and IRE1α may mediate miR-200a expression through RNase activity, so as to mediate TXNIP expression and pyroptosis.
⦁ HG-induced NRK-52E upregulated ERS and pyroptosis
The activity of HG-induced NRK-52E cells gradually weakened with the increase of time (Figure 4A). We chose NRK-52E cells after 48 hours of HG induction for subsequent experiments. The expression of KIM-1, IL-1β and IL-18 in HG-induced NRK-52E cells was significantly upregulated (Figure 4B, all p < 0.01). After that, the expression of TXNIP, NLRP3, ASC, cleaved caspase-1 and GSDMD-N was markedly increased, and IRE1α phosphorylation was elevated (Figure 4D, all p < 0.01). TUNEL staining showed a significant increase in cell death (Figure 4C, p < 0.01), indicating that HG induced ERS and pyroptosis in NRK-52E cells. To explore the crosstalk between TXNIP and pyroptosis, we observed the direct interaction between TXNIP and NLRP3. We observed the binding of TXNIP and NLRP3 through co-immunoprecipitation. However, the binding of TXNIP to NLRP3 in HG-induced cells was more than that in the control group, indicating the direct interaction between TXNIP and NLRP3 was increased (Figure 4E).
⦁ Inhibition of TXNIP reduced HG-induced pyroptosis of NRK-52E cells
We transfected NRK-52E cells with LV-TXNIP-shRNA 2 hours before HG induction, and found that the activity of cells transfected with LV-TXNIP-shRNA was higher than those transfected with LV-NC after 48 hours of HG induction, while the expression of KIM-1, IL-1β and IL-18 was significantly downregulated (Figure 5A, all p < 0.05). The cell death was relieved, and the expression of NLRP3, ASC, cleaved caspase-1 and GSDMD-N was notably downregulated (Figure 5B-D, all p < 0.01). However, the co-immunoprecipitation of TXNIP and NLRP3 showed that TXNIP inhibition inhibited the binding of TXNIP to NLRP3 (Figure 5E).
⦁ Inhibition of miR-200a partially reversed pyroptosis of renal tubular epithelial cells reduced by the IRE1α inhibitor STF-083010
As shown in Figure 6A-D, NRK-52E cells treated with STF-083010 showed increased cell viability, decreased IRE1α phosphorylation and XBP-1s expression, and reduced levels of KIM-1, IL-1β and IL-18, but these trends were reversed by inhibiting miR-200a expression in STF-083010-treated NRK-52E cells (all p < 0.01). Additionally, inhibition of miR-200a compromised the decreased expression of TXNIP, ASC, NLRP3, cleaved caspase-1 and GSDMD-N and cell death caused by STF-083010, indicating that inhibition of miR-200a partially reversed the decreased pyroptosis of renal tubular epithelial cells by IRE1α inhibitor STF-083010 (Figure 6E/F, all p < 0.01).
⦁ Discussion
DN is still a common and independent risk factor for kidney and cardiovascular diseases, and is associated with significant incidence rate and mortality [37, 38]. Recently, the participation of pyroptosis in DN progression has attached much attention [39, 40]). The NLRP3 inflammasomes trigger inflammatory responses and pyroptosis [41]). Interaction between TXNIP and NLRP3 is critical for NLRP3 inflammasome activation [20]). ERS can regulate pyroptosis by the TXNIP/NLRP3 axis [30]). So we focused on the relationship among TXNIP, NLRP3 and ERS in pyroptosis in DN progression. In this study, we unveiled that ERS-related factor IRE1α upregulated TXINP expression in DN rats by degrading miR-200a, and stimulated the NLRP3/TXNIP pathway-mediated pyroptosis and kidney damage (Figure 7).
NLRP3/ASC dependent inflammatory responses release caspase-1 and IL-1β, and these innate immune responses are important in DN [42, 43]. The activated caspase-1, an executor caspase of pyroptosis, induced by NLRP3 inflammasome, is
enhanced in diabetic rats [24, 44]. In this study, in DN rats and HG-induced NRK-52E cells, the levels of NLRP3 inflammasome components (NLRP3, ASC and cleaved caspase-1) were significantly upregulated. The NLRP3 inflammasome and pyroptosis-related factors (cleaved caspase-1 and IL-1β) were increased in diabetic rats [41]. NLRP inflammasomes induce pyroptosis in multi-organ diseases and pathological injury [45]. Murine caspase-11 induces pyroptosis and promotes processing of IL-1β through the NLRP3-ASC-caspase-1 pathway [46]. These manifestations suggest the occurrence of pyroptosis in DN rat and cell models.
TXNIP is upregulated by HG induction and is associated with oxidative stress and apoptosis [19]. TXNIP was increased in DN rats and HG-induced NRK-52E cells. Diabetic mice exhibit increased TXNIP expression, while TXNIP-deficient mice are relatively protected from STZ-induced diabetes [47]. After inhibiting TXNIP expression using LV-TXNIP-shRNA, the levels of NLRP3 inflammasome components, IL-1β, and IL-18 were significantly reduced, and cell death was inhibited. TXNIP deficiency prevented activation of NLRP3 inflammasome and IL-1β secretion [20]. Additionally, the content of BUN, Scr and mALB in sera of DN rats injected with LV-TXNIP-shRNA were significantly reduced; GSI was reduced, and FN expression was increased, KIM-1 expression was significantly downregulated. TXNIP siRNA decreased the inflammatory damage in the kidney of BDE-47-treated mice [48]. The lack of TXNIP was associated with protection from the pro-fibrotic signaling to collagen expression by HG [19]. All in all, the TXNIP/NLRP3 axis was activated in DN, triggered the release of inflammatory factors and ultimately induced pyroptosis and renal damage. While silencing TXNIP inhibited NLRP3 inflammasome-mediated pyroptosis and reduced renal injury in DN.
ERS can regulate pyroptosis by the TXNIP/NLRP3 axis [34]. IRE1α is a transducer of the UPR in cells under ERS [27]. We discovered that levels of ATF4, CHOP and the phosphorylation of IRE1α in DN rats were significantly increased. Overactivated ERS may lead to pyroptosis of NRK-52E cells by activating CHOP [49]. The levels of ERS-related proteins were downregulated in association with decreased diabetic kidney injury [50]. ERS indirectly induces kinase/RNAse-TXNIP expression and then activates NLRP3 inflammasome and caspase-1 [51]. These results suggested activated ERS in DN rats, and IRE1α may mediate TXNIP expression and pyroptosis through miR-200a degradation.
After inhibition of IRE1α expression, TXNIP levels were evidently downregulated in DN rats. IRE1α induced TXNIP to activate NLRP3 inflammasome, IL-1β secretion, and programmed cell death under irremediable ERS [52]. What’s more, miRs are main mediators of ER homeostasis and UPR pathway in DN [30, 53]. We found IRE1α mediated the degradation of miR-200a, and miR-200a bound to TXNIP. IRE1a-induced UPR pathway led to aggravated inflammation and brain injury via NLRP3 inflammasome activation and TXNIP upregulation through miR-17-5p [30]. STF-083010 remarkably inhibited the apoptosis [30]. Furthermore, inhibition of miR-200 can relieve hepatic steatosis in Ire1α-null hepatocytes [27]. NRK-52E cells treated with STF-083010 showed increased cell viability, decreased IRE1α phosphorylation and reduced levels of KIM-1, IL-1β and IL-18, but these trends were reversed by inhibiting miR-200a expression in STF-083010-treated NRK-52E cells. The downregulation of miR-200a was a key event of fructose-induced activation of TXNIP/NLRP3 inflammasome in hepatocytes [54]. These further confirmed the association among miR-200a, TXNIP and NLRP3.
Inhibition of miR-200a partially reversed pyroptosis of NRK-52E cells reduced by STF-083010.
By the way, another ER transmembrane sensor PERK can initiate the UPR pathways and is activated as the earliest signaling event in cells experiencing ERS [52]. ROS-mediated ERS relies on PERK to propagate apoptosis and apoptosis is the second signal for NLRP3 inflammasome activation [55]. Moreover, overactivation of PERK and IRE1α induces TXNIP elevation, which, in turn, activates the NLRP3 inflammasome [56]. From these documents, we found that PERK is probably an important link in the network off IRE1α-miR-200a-TXNIP/NLRP3. However, considering the current experimental cycle and funding constraints, we failed to study the role of PERK and related mechanisms. In the future, we will take PERK as the focus of our research and explore the specific role of PERK in response to HG treatment.
Based on the above findings, we concluded that IRE1α activation in DN might affect the progression of DN through specific degradation of miR-200a and regulation of the TXNIP/NLRP3 inflammasome-induced pyroptosis. ERS and pyroptosis are important in the development of DN, but little attention has been paid to their mechanism in DN. In this study, we focused on the regulation of miR-200a by the ERS-related factor IRE1α, which upregulated TXNIP/NLRP3 inflammasome-induced pyroptosis. Therefore, this study sheds more insights for further understanding the mechanism of DN, and may facilitate novel treatment for DN patients. However, in this study, we only studied the I ERS-related factor IRE1α and TXNIP/NLRP3 signal axis in pyroptosis, but the mechanism of ERS and pyroptosis are complex, and the role between them needs more experiments to for further validation.
Declarations
Author contributions
RQK is the guarantor of integrity of the entire study; RQK contributed to the study concepts, study design, and definition of intellectual content, YW contributed to the manuscript preparation and SHH contributed to the manuscript editing and review; RQK contributed to the clinical studies; YW and SHH contributed to the experimental studies and data acquisition; LXX contributed to the data analysis and statistical analysis. All authors read and approved the final manuscript.
Funding
Not applicable.
Acknowledgements
Not applicable.
Availability of data and materials
All the data generated or analyzed during this study are included in this published article.
Competing Interests
The authors declared that they have no competing interests.
References
⦁ Sinha N, Kumar V, Puri V, Nada R, Rastogi A, Jha V and Puri S: Urinary Exosomes: Potential Biomarkers for Diabetic Nephropathy. Nephrology (Carlton) (2020)
⦁ Dong C, Liu S, Cui Y and Guo Q: 12-Lipoxygenase as a key pharmacological target in the pathogenesis of diabetic nephropathy. Eur J Pharmacol 879 (2020) 173122.
⦁ Elsherbiny NM and Al-Gayyar MM: The role of IL-18 in type 1 diabetic nephropathy: The problem and future treatment. Cytokine 81 (2016) 15-22.
⦁ Zhang J, Wang L, Gong D, Yang Y, Liu X and Chen Z: Inhibition of the SIRT1 signaling pathway exacerbates endoplasmic reticulum stress induced by renal ischemia/reperfusion injury in type 1 diabetic rats. Mol Med Rep 21 (2020) 695-704.
⦁ Zhuang A and Forbes JM: Stress in the kidney is the road to pERdition: is endoplasmic reticulum stress a pathogenic mediator of diabetic nephropathy? J Endocrinol 222 (2014) R97-111.
⦁ De Blasio MJ, Ramalingam A, Cao AH, Prakoso D, Ye JM, Pickering R, Watson AMD, de Haan JB, Kaye DM and Ritchie RH: The superoxide dismutase mimetic tempol blunts diabetes-induced upregulation of NADPH oxidase and endoplasmic reticulum stress in a rat model of diabetic nephropathy. Eur J Pharmacol 807 (2017) 12-20.
⦁ Dehdashtian E, Pourhanifeh MH, Hemati K, Mehrzadi S and Hosseinzadeh A: Therapeutic Application of Nutraceuticals in Diabetic Nephropathy: Current Evidence and Future Implications. Diabetes Metab Res Rev (2020)
⦁ Qi W, Mu J, Luo ZF, Zeng W, Guo YH, Pang Q, Ye ZL, Liu L, Yuan FH and Feng B: Attenuation of diabetic nephropathy in diabetes rats induced by streptozotocin by regulating the endoplasmic reticulum stress inflammatory response. Metabolism 60 (2011) 594-603.
⦁ Man SM, Karki R and Kanneganti TD: Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases. Immunol Rev 277 (2017) 61-75.
⦁ Jorgensen I, Lopez JP, Laufer SA and Miao EA: IL-1beta, IL-18, and eicosanoids promote neutrophil recruitment to pore-induced intracellular traps following pyroptosis. Eur J Immunol 46 (2016) 2761-2766.
⦁ Dong T, Liao D, Liu X and Lei X: Using Small Molecules to Dissect Non-apoptotic Programmed Cell Death: Necroptosis, Ferroptosis, and Pyroptosis. Chembiochem 16 (2015) 2557-2561.
⦁ Yu ZW, Zhang J, Li X, Wang Y, Fu YH and Gao XY: A new research hot spot: The role of NLRP3 inflammasome activation, a key step in pyroptosis, in diabetes and diabetic complications. Life Sci 240 (2020) 117138.
⦁ Xia X, Wang X, Zheng Y, Jiang J and Hu J: What role does pyroptosis play in microbial infection? J Cell Physiol 234 (2019) 7885-7892.
⦁ Zeng C, Wang R and Tan H: Role of Pyroptosis in Cardiovascular Diseases and its Therapeutic Implications. Int J Biol Sci 15 (2019) 1345-1357.
⦁ Ruan J, Wang S and Wang J: Mechanism and regulation of pyroptosis-mediated in cancer cell death. Chem Biol Interact 323 (2020) 109052.
⦁ Chi K, Geng X, Liu C, Cai G and Hong Q: Research Progress on the Role of Inflammasomes in Kidney Disease. Mediators Inflamm 2020 (2020) 8032797.
⦁ Wu XL, Deng MZ, Gao ZJ, Dang YY, Li YC and Li CW: Neferine alleviates memory and cognitive dysfunction in diabetic mice through modulation of the NLRP3 inflammasome pathway and alleviation of endoplasmic-reticulum stress. Int Immunopharmacol 84 (2020) 106559.
⦁ Advani A, Gilbert RE, Thai K, Gow RM, Langham RG, Cox AJ, Connelly KA, Zhang Y, Herzenberg AM, Christensen PK, Pollock CA, Qi W, Tan SM, Parving HH and Kelly DJ: Expression, localization, and function of the thioredoxin system in diabetic nephropathy. J Am Soc Nephrol 20 (2009) 730-741.
⦁ Shah A, Xia L, Goldberg H, Lee KW, Quaggin SE and Fantus IG: Thioredoxin-interacting protein mediates high glucose-induced reactive oxygen species generation by mitochondria and the NADPH oxidase, Nox4, in mesangial cells. J Biol Chem 288 (2013) 6835-6848.
⦁ Zhou R, Tardivel A, Thorens B, Choi I and Tschopp J: Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat Immunol 11 (2010) 136-140.
⦁ Huang H, Ni H, Ma K and Zou J: ANGPTL2 regulates autophagy through the MEK/ERK/Nrf-1 pathway and affects the progression of renal fibrosis in diabetic nephropathy. Am J Transl Res 11 (2019) 5472-5486.
⦁ Danda RS, Habiba NM, Rincon-Choles H, Bhandari BK, Barnes JL, Abboud HE and Pergola PE: Kidney involvement in a nongenetic rat model of type 2 diabetes. Kidney Int 68 (2005) 2562-2571.
⦁ Lee J, Cummings BP, Martin E, Sharp JW, Graham JL, Stanhope KL, Havel PJ and Raybould HE: Glucose sensing by gut endocrine cells and activation of the vagal afferent pathway is impaired in a rodent model of type 2 diabetes mellitus. Am J Physiol Regul Integr Comp Physiol 302 (2012) R657-666.
⦁ Luo B, Li B, Wang W, Liu X, Xia Y, Zhang C, Zhang M, Zhang Y and An F: NLRP3 gene silencing ameliorates diabetic cardiomyopathy in a type 2 diabetes rat model. PLoS One 9 (2014) e104771.
⦁ Ye Z, Zhang L, Li R, Dong W, Liu S, Li Z, Liang H, Wang L, Shi W, Malik AB, Cheng KT and Liang X: Caspase-11 Mediates Pyroptosis of Tubular Epithelial Cells and Septic Acute Kidney Injury. Kidney Blood Press Res 44 (2019) 465-478.
⦁ An P, Xie J, Qiu S, Liu Y, Wang J, Xiu X, Li L and Tang M: Hispidulin exhibits neuroprotective activities against cerebral ischemia reperfusion injury through suppressing NLRP3-mediated pyroptosis. Life Sci 232 (2019) 116599.
⦁ Wang JM, Qiu Y, Yang Z, Kim H, Qian Q, Sun Q, Zhang C, Yin L, Fang D, Back SH, Kaufman RJ, Yang L and Zhang K: IRE1alpha prevents hepatic steatosis by
processing and promoting the degradation of select microRNAs. Sci Signal 11 (2018)
⦁ Heindryckx F, Binet F, Ponticos M, Rombouts K, Lau J, Kreuger J and Gerwins P: Endoplasmic reticulum stress enhances fibrosis through IRE1alpha-mediated degradation of miR-150 and XBP-1 splicing. EMBO Mol Med 8 (2016) 729-744.
⦁ Luo T, Yu Q, Zou H, Zhao H, Gu J, Yuan Y, Zhu J, Bian J and Liu Z: Role of poly (ADP-ribose) polymerase-1 in cadmium-induced cellular DNA damage and cell cycle arrest in rat renal tubular epithelial cell line NRK-52E. Environ Pollut 261 (2020) 114149.
⦁ Chen D, Dixon BJ, Doycheva DM, Li B, Zhang Y, Hu Q, He Y, Guo Z, Nowrangi D, Flores J, Filippov V, Zhang JH and Tang J: IRE1alpha inhibition decreased TXNIP/NLRP3 inflammasome activation through miR-17-5p after neonatal hypoxic-ischemic brain injury in rats. J Neuroinflammation 15 (2018) 32.
⦁ Li JH, Liu S, Zhou H, Qu LH and Yang JH: starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res 42 (2014) D92-97.
⦁ Liu X, Zhang YR, Cai C, Ni XQ, Zhu Q, Ren JL, Chen Y, Zhang LS, Xue CD, Zhao J, Qi YF and Yu YR: Taurine Alleviates Schistosoma-Induced Liver Injury by Inhibiting the TXNIP/NLRP3 Inflammasome Signal Pathway and Pyroptosis. Infect Immun 87 (2019)
⦁ Heo MJ, Kim TH, You JS, Blaya D, Sancho-Bru P and Kim SG: Alcohol dysregulates miR-148a in hepatocytes through FoxO1, facilitating pyroptosis via TXNIP overexpression. Gut 68 (2019) 708-720.
⦁ Dong F, Dong S, Liang Y, Wang K, Qin Y and Zhao X: miR20b inhibits the senescence of human umbilical vein endothelial cells through regulating the Wnt/betacatenin pathway via the TXNIP/NLRP3 axis. Int J Mol Med 45 (2020) 847-857.
⦁ Wu H, Kong L, Tan Y, Epstein PN, Zeng J, Gu J, Liang G, Kong M, Chen X, Miao L and Cai L: C66 ameliorates diabetic nephropathy in mice by both upregulating NRF2 function via increase in miR-200a and inhibiting miR-21. Diabetologia 59 (2016) 1558-1568.
⦁ Wei J, Zhang Y, Luo Y, Wang Z, Bi S, Song D, Dai Y, Wang T, Qiu L, Wen L, Yuan L and Yang JY: Aldose reductase regulates miR-200a-3p/141-3p to coordinate Keap1-Nrf2, Tgfbeta1/2, and Zeb1/2 signaling in renal mesangial cells and the renal cortex of diabetic mice. Free Radic Biol Med 67 (2014) 91-102.
⦁ Gupta S, Goyal P, Feinn RS and Mattana J: Role of Vitamin D and Its Analogues in Diabetic Nephropathy: A Meta-analysis. Am J Med Sci 357 (2019) 223-229.
⦁ Esfandiari A, Pourghassem Gargari B, Noshad H, Sarbakhsh P, Mobasseri M, Barzegari M and Arzhang P: The effects of vitamin D3 supplementation on some metabolic and inflammatory markers in diabetic nephropathy patients with
marginal status of vitamin D: A randomized double blind placebo controlled clinical trial. Diabetes Metab Syndr 13 (2019) 278-283.
⦁ Liu C, Zhuo H, Ye MY, Huang GX, Fan M and Huang XZ: LncRNA MALAT1 promoted high glucose-induced pyroptosis of renal tubular epithelial cell by sponging miR-30c targeting for NLRP3. Kaohsiung J Med Sci (2020)
⦁ Fang Y, Tian S, Pan Y, Li W, Wang Q, Tang Y, Yu T, Wu X, Shi Y, Ma P and Shu Y: Pyroptosis: A new frontier in cancer. Biomed Pharmacother 121 (2020) 109595.
⦁ Qiu Z, Lei S, Zhao B, Wu Y, Su W, Liu M, Meng Q, Zhou B, Leng Y and Xia ZY: NLRP3 Inflammasome Activation-Mediated Pyroptosis Aggravates Myocardial Ischemia/Reperfusion Injury in Diabetic Rats. Oxid Med Cell Longev 2017 (2017) 9743280.
⦁ Takahashi M: NLRP3 in myocardial ischaemia-reperfusion injury: inflammasome-dependent or -independent role in different cell types. Cardiovasc Res 99 (2013) 4-5.
⦁ Sandanger O, Ranheim T, Vinge LE, Bliksoen M, Alfsnes K, Finsen AV, Dahl CP, Askevold ET, Florholmen G, Christensen G, Fitzgerald KA, Lien E, Valen G, Espevik T, Aukrust P and Yndestad A: The NLRP3 inflammasome is up-regulated in cardiac fibroblasts and mediates myocardial ischaemia-reperfusion injury. Cardiovasc Res 99 (2013) 164-174.
⦁ Giordano A, Murano I, Mondini E, Perugini J, Smorlesi A, Severi I, Barazzoni R, Scherer PE and Cinti S: Obese adipocytes show ultrastructural features of stressed cells and die of pyroptosis. J Lipid Res 54 (2013) 2423-2436.
⦁ Kovarova M, Hesker PR, Jania L, Nguyen M, Snouwaert JN, Xiang Z, Lommatzsch SE, Huang MT, Ting JP and Koller BH: NLRP1-dependent pyroptosis leads to acute lung injury and morbidity in mice. J Immunol 189 (2012) 2006-2016.
⦁ Kayagaki N, Warming S, Lamkanfi M, Vande Walle L, Louie S, Dong J, Newton K, Qu Y, Liu J, Heldens S, Zhang J, Lee WP, Roose-Girma M and Dixit VM: Non-canonical inflammasome activation targets caspase-11. Nature 479 (2011) 117-121.
⦁ Masson E, Koren S, Razik F, Goldberg H, Kwan EP, Sheu L, Gaisano HY and Fantus IG: High beta-cell mass prevents streptozotocin-induced diabetes in thioredoxin-interacting protein-deficient mice. Am J Physiol Endocrinol Metab 296 (2009) E1251-1261.
⦁ Shan Q, Zheng GH, Han XR, Wen X, Wang S, Li MQ, Zhuang J, Zhang ZF, Hu B, Zhang Y and Zheng YL: Troxerutin Protects Kidney Tissue against BDE-47-Induced Inflammatory Damage through CXCR4-TXNIP/NLRP3 Signaling. Oxid Med Cell Longev 2018 (2018) 9865495.
⦁ Yang JR, Yao FH, Zhang JG, Ji ZY, Li KL, Zhan J, Tong YN, Lin LR and He YN: Ischemia-reperfusion induces renal tubule pyroptosis via the CHOP-caspase-11 pathway. Am J Physiol Renal Physiol 306 (2014) F75-84.
⦁ Liu T, Duan W, Nizigiyimana P, Gao L, Liao Z, Xu B, Liu L and Lei M: Alpha-mangostin attenuates diabetic nephropathy in association with suppression
of acid sphingomyelianse and endoplasmic reticulum stress. Biochem Biophys Res Commun 496 (2018) 394-400.
⦁ Soczewski E, Grasso E, Gallino L, Hauk V, Fernandez L, Gori S, Paparini D, Perez Leiros C and Ramhorst R: Immunoregulation of the decidualization program: focus on the endoplasmic reticulum stress. Reproduction 159 (2020) R203-R211.
⦁ Lerner AG, Upton JP, Praveen PV, Ghosh R, Nakagawa Y, Igbaria A, Shen S, Nguyen V, Backes BJ, Heiman M, Heintz N, Greengard P, Hui S, Tang Q, Trusina A, Oakes SA and Papa FR: IRE1alpha induces thioredoxin-interacting protein to activate the NLRP3 inflammasome and promote programmed cell death under irremediable ER stress. Cell Metab 16 (2012) 250-264.
⦁ Bai X, Geng J, Li X, Wan J, Liu J, Zhou Z and Liu X: Long Noncoding RNA LINC01619 Regulates MicroRNA-27a/Forkhead Box Protein O1 and Endoplasmic Reticulum Stress-Mediated Podocyte Injury in Diabetic Nephropathy. Antioxid Redox Signal 29 (2018) 355-376.
⦁ Ding XQ, Wu WY, Jiao RQ, Gu TT, Xu Q, Pan Y and Kong LD: Curcumin and allopurinol ameliorate fructose-induced hepatic inflammation in rats via miR-200a-mediated TXNIP/NLRP3 inflammasome inhibition. Pharmacol Res 137 (2018) 64-75.
⦁ Zhou Y, Tong Z, Jiang S, Zheng W, Zhao J and Zhou X: The Roles of Endoplasmic Reticulum in NLRP3 Inflammasome Activation. Cells 9 (2020)
⦁ Cheng SB, Nakashima A, Huber WJ, Davis S, Banerjee S, Huang Z, Saito S, Sadovsky Y and Sharma S: Pyroptosis is a critical inflammatory pathway in the placenta from early onset preeclampsia and in human trophoblasts exposed to hypoxia and endoplasmic reticulum stressors. Cell Death Dis 10 (2019) 927.
Legends
Supplementary figure 1 Identification of the DN rat model. A, the blood glucose content in the sera of DN rats was evaluated through a blood glucose meter; B, the contents of BUN (I) and Scr (II) in sera and mALB (III) in urine of DN rats were measured to reflect the renal injury. Histopathological experiments HE staining was used to observe the renal morphology of DN rats (I), Sirius red staining to observe the renal collagen deposition (II), PAS staining to observe the GSI (III) and immunohistochemistry to observe the FN pathological deposition (IV); D, KIM-1 level in the kidney of DN rats was examined by ELISA. N=6 in each group. The results are presented as mean ± standard deviation. The data were analyzed by the t test. **p <0.01.
Figure 1 DN rats activated pyroptosis in renal cells. A, Western blot analysis was used to detect the protein levels of TXNIP, NLRP3, ASC, cleaved caspase-1 and GSDMD-N in the kidney of DN rats; B, the levels of IL-1 β and IL-18 in the kidney of DN rats were detected by ELISA; C, TUNEL staining was used to detect the cell death in the kidney of DN rats. N=6 in each group. The data are presented as mean ± standard deviation and analyzed by two-way ANOVA. **p <0.01.
Figure 2 Inhibition of TXNIP reduced renal injury in DN rats. A, the contents of BUN (I) and Scr (II) in sera and mALB (III) in urine of DN rats were measured to reflect the renal injury; B, histopathological experiments HE staining was used to observe the renal morphology of DN rats (I), Sirius red staining to observe the renal collagen deposition (II), PAS staining to observe the GSI (III) and immunohistochemistry to observe the FN pathological deposition (IV); C, the expression of KIM-1 in DN rats was detected by ELISA. N=6 in each group. The data are presented as mean ± standard deviation and analyzed by the t test. **p <0.01.
Figure 3 Inhibition of IRE1α activity upregulated miR-200a to downregulate TXNIP. A, Western blot was used to detect the protein expression of ATF4, CHOP and IRE1α in the kidney of DN rats; B/C, the levels XBP-1s was analyzed by qRT-PCR and Western blot analysis; D, the effect of STF-083010 on miR-200a expression in DN rats; E, the specific binding site between miR-200a and TXNIP was confirmed by bioinformatics prediction and dual-luciferase assay; F/G, TXNIP levels after STF-083010 treatment were detected by qRT-PCR and Western blot analysis. The experiment was repeated three times. The data are presented as mean ± standard deviation. The data in panel A were by two-way ANOVA, data in panels B/C were analyzed by one-way ANOVA, and data in panel D/G were analyzed by the t test. **p
<0.01.
Figure 4 HG-induced NRK-52E upregulated ERS and pyroptosis. A, MTT assay was used to detect the activity of HG-induced NRK-52E cells; B, the expression of KIM-1, IL-1β and IL-18 in NRK-52E cells was detected by ELISA; C, TUNEL staining was used to detect cell death; D, Western blot analysis was used to detect the expression of IRE1α, TXNIP, ASC, NLRP3, cleaved caspase-1 and GSDMD-N; E, the binding of TXNIP to NLRP3 in NRK-52E cells was detected by co-immunoprecipitation. The experiment was repeated three times. The data are presented as mean ± standard deviation. The data in panels A/B/D were analyzed by two-way ANOVA, data in panels B/C were analyzed by the t test. **p <0.01.
Figure 5 Inhibition of TXNIP reduced HG-induced pyroptosis of NRK-52E cells. A, MTT assay was used to detect the activity of HG-induced NRK-52E cells; B, the expression of KIM-1, IL-1β and IL-18 in NRK-52E cells was detected by ELISA; C, TUNEL staining was used to detect cell death; D, Western blot analysis was used to detect the expression of IRE1α, TXNIP, ASC, NLRP3, cleaved caspase-1 and
GSDMD-N; E, the binding of TXNIP to NLRP3 in NRK-52E cells was detected by co-immunoprecipitation. The experiment was repeated three times. The data are presented as mean ± standard deviation. The data in panels A/D were analyzed by two-way ANOVA, and data in panels B/C were analyzed by the t test. *p < 0.05, **p
<0.01.
Figure 6 Inhibition of miR-200a partially reversed pyroptosis of renal tubular epithelial cells reduced by the IRE1α inhibitor STF-083010. A, MTT assay was used to detect the activity of NRK-52E cells; B, the expression of XBP-1s was detected by semi quantitative PCR; C, Western blot analysis was used to detect the expression of IRE1α and XBP-1s; D, the expression of KIM-1, IL-1β and IL-18 in NRK-52E cells was detected by ELISA; E, TUNEL staining was used to detect cell death; F, Western blot was used to detect the expression of TXNIP, NLRP3, cleaved caspase-1 and GSDMD-N. The experiment was repeated three times. The data are presented as mean
± standard deviation. The data in panels A-C were analyzed by two-way ANOVA, and data in panel B were analyzed by one-way ANOVA. *p < 0.05, **p <0.01.
Figure 7 Role model of IRE1-α in diabetic nephropathy
Table 1 Primer sequences
Gene Forward (5’-3’) Reverse (5’-3’)
TXNIP AAGCGTTGAGTAGTACAGATGAG GGTATGGCGTGGCAAGAGTC
GAPDH GATGGTGAAGGTCGGTGTG GAGGTCAATGAAGGGGTCG
miR-200a ACACTCCAGCTGGGTAACACTGTCTGGTAA TGGTGTCGTGGAGTCG
U6 CTCGCTTCGGCAGCACA TGGTGTCGTGGAGTCG
Note: TXNIP, Thioredoxin interacting protein;GAPDH, glyceraldehyde-3-phosphate dehydrogenase;miR, microRNA.
Competing Interests
The authors declared that they have no competing interests.