In contrast, the four SXT susceptible isolates (two ST88 isolates

In contrast, the four SXT susceptible isolates (two ST88 isolates, one ST84 isolate and one ST94 isolate) were grouped together as two pairs of isolates on different branches of the tree and are likely to have not Selleckchem Eltanexor gained the SXT element. Resistance to the other antibiotics may be due to chromosomal mutations, Selleck AZD7762 plasmids or other mobile elements [38] and are more difficult to make any evolutionary inference of the observed resistance patterns. Detection and distribution of virulence factors genes PCR assays (Table 2) were used

for the detection of the ctxAB[39], tcpA[40], zot[41], NAG-ST [16], T3SS (vcsC2 and vcsV2) [16, 28], ompW[42], toxR[42] and hlyA genes [43]. All isolates were positive for V. cholerae specific gene ompW by PCR, but were negative for ctxAB, zot, tcpA and NAG-ST. All isolates were positive for toxR (Table 1), except for N743 which was toxR negative.

Interestingly, N743 also differed from other ST80 isolates in its PFGE pattern. toxR codes for the transcriptional regulatory protein ToxR [44] and is expected to be present in all V. cholerae isolates. Negative PCR amplification of toxR from N743 may be due to sequence divergence in primer binding regions. Similarly, all isolates were positive for the haemolysin gene hlyA (Table 1). In contrast, the absence of ctxAB, zot, tcpA and NAG-ST suggests that these non-O1/non-O139 isolates caused diarrhoea by a different mechanism from that used by toxigenic V. cholerae O1 and O139. Table 2 PCR primers used in this Selleckchem Bioactive Compound Library study Gene target Primer sequence (5’-3’) Probe Ta* Amplicon size (bp) Reference Forward Reverse ompW TCCTCAACGCTTCTGTGTGGTAT ATTGATTTCAACATCCGTGGATT FAM-TGAAACAACGGCAACCTACAAAGCAGG-BHQ1 55 92 This study hlyA AGTGGTCAACCGATGCGATT TTCAGGATCTGCGCTTTATTGTT ROX-CCCAAGATTATCGCTTCGTGTTTAACGCA- BHQ2 47-55 76 This study toxR GATTCGACAAAGTCCCCACAA TCGGGCGATCAATTGGTAA HEX-CGTCAAAACGGTTCCGAAACGCG-BHQ1 47-55 66 This study ctxAB

CTCAGACGGGATTTGTTAGGCACG TCTATCTCTGTAGCCCCTATTACG – 55 303 [39] tcpA Glutamate dehydrogenase (1) # GTGACTGAAAGTCATCTCTTC AATCCGACACCTTGTTGGTA – 55 1248 [40] tcpA (2) # ATATGCAATTATTAAAACAGC TTATTATTACCCGTTGTCGG – 55 1052 [40] ace AGAGCGCTGCATTTATCCTTATTG AACTCGGTCTCGGCCTCTCGTATC – 55 655 [41] zot GCTATCGATATGCTGTCTCCTCAA AAAGCCGACCAATACAAAAACCAA – 55 1000 [41] T3SS (vcsC2) GGAAAGATCTATGCGTCGACGTTACCGATGCTATGGGT CATATGGAATTCCCGGGATCCATGCTCT AGAAGTCGGTTGTTTCGGTAA – 47-60 535 [16] T3SS (vcsV2) ATGCAGATCTTTTGGCTCACTTGATGGG ATGCGTCGACGCCACATCATTGCTTGCT – 47-55 742 [16] NAG-ST CCTATTCATTAGCATAATG CCAAAGCAAGCTGGATTGC – 47-55 215 [16] * Ta – Annealing temperature. # Two primer pairs of tcpA primers were used. These two primer pairs have been used previously to amplify divergent tcpA alleles [24]. Recent reports suggest that T3SS is present in some non-O1/non-O139 isolates and plays an important role in virulence [16, 28]. We tested for the presence of T3SS using two T3SS genes (vcsC2 and vcsV2).

This entry was posted in Uncategorized. Bookmark the permalink.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>